rnapkin: drawing RNA secondary structure with style

Usage

rnapkin accepts a file containing secondary structure and optionally sequence and a name. For example you could have this marvelous RNA molecule sitting peacefully in a file called "guaniners" ```text

fantastic guanine riboswitch AAUAUAAUAGGAACACUCAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCAC ..........(..(.((((.((((..(((((.......)))))..........((((((. CGUAAAUGUCCGACUAUGGGUGAGCAAUGGAACCGCACGUGUACGGUUUUUUGUGAUAUC ......)))))).....((((((((((((((((((........))))))........... AGCAUUGCUUGCUCUUUAUUUGAGCGGGCAAUGCUUUUUUUA ..)))))))))))).)))).)))).)..)............. Then, if you wish to visualize it, you could invoke rnapkin thus: rnapkin guaniners Surely rnapkin would respond with the name of a file it has just drawn to: fantasticguanineriboswitch.svg ``` And this scalable vector graphic would be produced:

I happen to quite enjoy the outcome, so I would say: that's pretty neat Your mileage may vary though.

Rotating and flipping

If you'd like to see this or any other RNA molecule upside-down, tilted or what have you, there are some options listed below that you can use and combine: text -a / --angle <DEGREES> | starting Angle / boils down to clockwise rotation --mx | Mirror along X axis / aka vertical flip --my | Mirror along Y axis / aka horizontal flip

color themes can be changed by -t option as demonstrated; a config file allowing to define custom color themes is planned though unimplemented!()

Installing

I plan to offer precompiled binaries but for now you'll need rust. Easiest way to acquire rust is via rustup :crab:

Anywhere

bash cargo install rnapkin

WSL

Fontconfig is the default Fontmanagement utility on Linux and Unix but WSL may not have them installed; bash sudo apt-get install libfontconfig libfontconfig1-dev cargo install rnapkin

Input

input can be served to rnapkin as a file or be piped in:

bash rnapkin cmolecule.fa -a 20 -o crab echo ".......(((((......))))).....(((((......)))))......." | rnapkin -a 20 -o crab

input is quite flexible; it should contain secondary_structure and optionally name and sequence. Name has to start with ">" and can be overwritten with -o flag which has priority. Here are some variations of valid input files:

simple one

```text

you can add .png to the name to request png instead of svg

@ the same of course can be achieved with -o flag. * this is a comment btw: any symbol other than ">.()" works but prefer "#"

simple molecule.png ((((((((((..((((((.........))))))......).((((((.......))))))..))))))))) CGCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUGAAGUG ```

Highlighting!

There are 9 available colors denoted by 1-9, while 0 means None. For example consider input below representing SAM riboswitch in the OFF conformation according to smFRET study by Manz et al. 2017. By using numbers in the input we can mark aptamer forming helices P1, P2, P3, P4 #2-#5 and the TERMINATOR #1.

```text

offsam

0000022222222223333333333333333333333333333333333444444444444444444444444444444 AUAUCCGUUCUUAUCAAGAGAAGCAGAGGGACUGGCCCGACGAUGCUUCAGCAACCAGUGUAAUGGCGAUCAGCCAUGA .......((((((((....(((((...(((.....)))......)))))(((..(((((...(((((.....))))).)

4444444444555555555555555555555555555522222222222211111111111111111111111111111 CUAAGGUGCUAAAUCCAGCAAGCUCGAACAGCUUGGAAGAUAAGAAGAGACAAAAUCACUGACAAAGUCUUCUUCUUAA ))..)).)))........((((((.....))))))...)))))))).................((((((.((((...))

111111111111 GAGGACUUUUUU )).))))))... ```

only secondary structure

text .........(((..((((((...((((((((.....((((((((((...))))))..... (((((((...))))))).))))(((.....)))...)))).)))).))))))..)))..( (((.(((((..(((......))).)))))..))))(((((((((((((....)))))))) ))))).....

multiline

sequence and secondary structure can be separate, mixed and aligned, everything should work.

DIY

using -p / --points flag you can make rnapkin print calculated coordinates of nucleotide bubbles (with 0.5 unit radius). You can then plot it yourself if you need to do something specific;

If you happen to clone the repository, there is an example python script using matplotlib that you can pipe the input to.

bash cargo run -- atelier/example_inputs/guaniners -p | atelier/plot.py

You can also combine -p flag with --mx --my and -a

rnapkin name

The wordsmithing proccess was arduous. It involved googling "words starting with na" and looking for anything drawing related. Once the word was found, unparalled strength was employed to slap it on top of "rna" ultimately creating this glorious amalgamation.

why it kinda makes sense:

You ever heard of all those physicists, mathematicians and the like, scribbling formulas on the back of a napkin ~~or a book margin~~? There is even a wikipedia page about it.

It doesn't take much mental gymnastic to imagine a biologist frantically scrambling together rna structure on a napkin. I am currently working on baiting my biologist friend into heated rna debate while in close proximity to abundant napkin source in order to produce a proof of concept.