rnapkin accepts a file containing secondary structure and optionally sequence and a name. For example: ```
remarkable molecule UUAUAGGCGAUGGAGUUCGCCAUAAACGCUGCUUAGCUAAUGACUCCUACCAGUAUCACUACUGGUAGGAGUCUAUUUUUUU .....(((((......)))))......(((....)))....((((((((((((((....))))))))))))))......... ``` The input format is not that rigid; you can have multiline sequences and structures. They can be even neatly aligned and mixed like this:
```text
fantastic molecule AATATAATAGGAACACTCATATAATCGCGTGGATATGGCACGCAAGTTTCTACCGGGCAC ..........(..(.((((.((((..(((((.......)))))..........((((((. CGTAAATGTCCGACTATGGGTGAGCAATGGAACCGCACGTGTACGGTTTTTTGTGATATC ......)))))).....((((((((((((((((((........))))))........... AGCATTGCTTGCTCTTTATTTGAGCGGGCAATGCTTTTTTTA ..)))))))))))).)))).)))).)..)............. ```
let's say the file above is called guanineribo, one could then run napkin thus:
rnapkin guanineribo
surely rnapkin would respond:
drawn: "fantastic_molecule.svg"
and this scalable vector graphic would be produced:
I quite like it, but if that looks upside down to you, you can tell rnapkin
to mirror it by --mx flag. Matter of fact you can apply arbitrary rotation
with -a / --angle
color themes can be changed by -t option as demonstrated; a config file allowing to define custom color themes is planned though unimplemented!()
I plan to offer precompiled binaries but for now you'll need rust. Easiest way to get it is with rustup :crab:
bash
cargo install rnapkin
Fontconfig is the default Fontmanagement utility on Linux and Unix but WSL may not have them installed;
bash
sudo apt-get install libfontconfig libfontconfig1-dev
cargo install rnapkin
The wordsmithing proccess was arduous. It involved googling "words starting with na" and looking for anything drawing related. Once the word was found, unparalled strength was employed to slap it on top of "rna" ultimately creating this glorious amalgamation.
You ever heard of all those physicists, mathematicians and the like, scribbling formulas on the back of a napkin ~~or a book margin~~? There is even a wikipedia page about it.
It doesn't take much mental gymnastic to imagine a biologist frantically scrambling together rna structure on a napkin. I am currently working on baiting my biologist friend into heated rna debate while in close proximity to abundant napkin source in order to produce a proof of concept.