rnapkin: drawing RNA secondary structure with style

Usage

rnapkin accepts a file containing secondary structure and optionally sequence and a name. For example: ```

name has to start with >

you can add .png / .svg to request specific output; though .svg is default

the name can be overwritten with -o flag

remarkable molecule UUAUAGGCGAUGGAGUUCGCCAUAAACGCUGCUUAGCUAAUGACUCCUACCAGUAUCACUACUGGUAGGAGUCUAUUUUUUU .....(((((......)))))......(((....)))....((((((((((((((....))))))))))))))......... ``` The input format is not that rigid; you can have multiline sequences and structures. They can be even neatly aligned and mixed like this:

```text

fantastic molecule AATATAATAGGAACACTCATATAATCGCGTGGATATGGCACGCAAGTTTCTACCGGGCAC ..........(..(.((((.((((..(((((.......)))))..........((((((. CGTAAATGTCCGACTATGGGTGAGCAATGGAACCGCACGTGTACGGTTTTTTGTGATATC ......)))))).....((((((((((((((((((........))))))........... AGCATTGCTTGCTCTTTATTTGAGCGGGCAATGCTTTTTTTA ..)))))))))))).)))).)))).)..)............. ```

let's say the file above is called guanineribo, one could then run napkin thus: rnapkin guanineribo surely rnapkin would respond: drawn: "fantastic_molecule.svg" and this scalable vector graphic would be produced:

color themes can be changed by -t flag; a config file allowing to define custom color themes is planned though unimplemented!()

Installing

I plan to offer precompiled binaries but for now you'll need rust. Easiest way to get it is with rustup :crab:

Anywhere

bash cargo install rnapkin

WSL

Fontconfig is the default Fontmanagement utility on Linux and Unix but WSL may not have them installed; bash sudo apt-get install libfontconfig libfontconfig1-dev cargo install rnapkin

rnapkin name

The wordsmithing proccess was arduous. It involved googling "words starting with na" and looking for anything drawing related. Once the word was found, unparalled strength was employed to slap it on top of "rna" ultimately creating this glorious amalgamation.

why it kinda makes sense:

You ever heard of all those physicists, mathematicians and the like, scribbling formulas on the back of a napkin ~~or a book margin~~? There is even a wikipedia page about it.

It doesn't take much mental gymnastic to imagine a biologist frantically scrambling together rna structure on a napkin. I am currently working on baiting my biologist friend into heated rna debate while in close proximity to abundant napkin source in order to produce a proof of concept.