A rust FFI library for minimap2. In development! Feedback appreciated!
minimap2-sys is the library of the raw FFI bindings to minimap2. minimap2 is the most rusty version.
Clang is required to build (probably....)
toml
minimap2 = "1.1.5"
Tested with rustc 1.64.0 and nightly. So probably a good idea to upgrade before running. But let me know if you run into pain points with older versions and will try to fix!
bash
rustup update
Create an Aligner
rust
let mut aligner = Aligner {
threads: 8,
..map_ont()
}
.with_cigar()
.with_index("ReferenceFile.fasta", None)
.expect("Unable to build index");
Align a sequence:
rust
let seq: Vec<u8> = b"ACTGACTCACATCGACTACGACTACTAGACACTAGACTATCGACTACTGACATCGA";
let alignment = aligner
.map(&seq, false, false, None, None)
.expect("Unable to align");
All minimap2 presets should be available (see functions section):
rust
let aligner = map_ont();
let aligner = asm20();
MapOpts and IdxOpts can be customized with Rust's struct pattern, as well as applying mapping settings. Inspired by bevy.
rust
Aligner {
mapopt: MapOpt {
seed: 42,
best_n: 1,
..Default::default()
},
idxopt: IdxOpt {
k: 21,
..Default::default()
},
..map_ont()
}
There is a binary called "fakeminimap2" that I am using to test for memory leaks. You can follow the source code for an example. It also shows some helper functions for identifying compression types and FASTA vs FASTQ files. I used my own parsers as they are well fuzzed, but open to removing them or putting them behind a feature wall.
Alignment functions return a Mapping struct. The Alignment struct is only returned when the Aligner is created using .with_cigar().
A very simple example would be: ```rust let mut file = std::fs::File::open(queryfile); let mut reader = BufReader::new(reader); let mut fasta = Fasta::frombuffer(&mut reader)
for seq in reader {
let seq = seq.unwrap();
let alignment: Vec
There is a map_file function that works on an entire file, but it is not-lazy and thus not suitable for large files. It may be removed in the future or moved to a separate lib.
rust
let mappings: Result<Vec<Mapping>> = aligner.map_file("query.fa", false, false);
Untested, however the thread_local buffer is already set, so theoretically it could work. I may or may not implement it in here, torn between a hold-your-hand library and a lightweight library for those who want to use their own solutions. This may get split into two separate libraries for that very reason (following the zstd concept).
So far multithreading only works for building the index and not for mapping.
Presets currently look like this:
rust
Aligner {
threads: 2,
..map_ont()
}
or:
rust
Aligner {
threads: 2,
..preset(Preset::MapOnt)
}
or:
rust
Aligner {
threads: 2,
..Aligner::preset(Preset::MapOnt)
}
The second pollutes the namespace less, but the first looks less redundant. Open to opinions.
Probably not freeing C memory somewhere.... Not sure yet, if so it's just leaking a little...
You should cite the minimap2 papers if you use this in your work. If you use this extensively, let me know and I'll add a way to cite this project as well with version.
Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics, 34:3094-3100. [doi:10.1093/bioinformatics/bty191][doi]
and/or:
Li, H. (2021). New strategies to improve minimap2 alignment accuracy. Bioinformatics, 37:4572-4574. [doi:10.1093/bioinformatics/btab705][doi2]