LtFmIndex

lt-fm-index is a library to (1) locate or (2) count the pattern in the large text of nucleotide and amino acid sequences.

Description

• FmIndex is a data structure for exact pattern matching.

• LtFmIndex is FmIndex using lookup table, the precalculated count of k-mer occurrences.

  • The lookup table can locate the first k-mer of pattern at once.

    Features

• LtFmIndex is built from Text (Vec<u8>).

• LtFmIndex have two functions.
  1. count: Count the number of times the Pattern (&[u8]) appears in the Text.
  2. locate: Locate the start index in which the Pattern appears in the Text.
• Four types of Text are supported.
  • NucleotideOnly: consists of {ACG}
  • NucleotideWithNoise: consists of {ACGT}
  • AminoacidOnly: consists of {ACDEFGHIKLMNPQRSTVW}
  • AminoacidWithNoise: consists of {ACDEFGHIKLMNPQRSTVWY}
• The * of each type is treated as a wildcard that can be matched with any characters.
  • For example,
    • If the TextType is NucleotideOnly, LtFmIndex stores the text of ACGTXYZ as ACG.
    • If the TextType is NucleotideWithNoise, LtFmIndex stores the same text (ACGTXYZ) as ACGT
    • If the indexed text is ACGT, the patterns of ACGTXXX, ACGT@@@, and ACGTX@# give the same result.
• Using fastbwt feature can accelerate the indexing, but needs cmake to build libdivsufsort and cannot be built as WASM.

  Examples

1. Use LtFmIndex to count and locate a pattern.

```rust use ltfmindex::LtFmIndexBuilder;

// (1) Define builder for lt-fm-index let builder = LtFmIndexBuilder::new() .texttypeisinferred() .setsuffixarraysamplingratio(2).unwrap() .setlookuptablekmer_size(4).unwrap();

// (2) Generate lt-fm-index with text let text = b"CTCCGTACACCTGTTTCGTATCGGANNNN".tovec(); let ltfm_index = builder.build(text).unwrap(); // text is consumed

// (3) Match with pattern let pattern = b"TA".tovec(); // - count let count = ltfmindex.count(&pattern); asserteq!(count, 2); // - locate let locations = ltfmindex.locate(&pattern); assert_eq!(locations, vec![5,18]); ```

2. Save and load LtFmIndex

```rust use ltfmindex::{LtFmIndex, LtFmIndexBuilder};

// (1) Generate lt-fm-index let text = b"CTCCGTACACCTGTTTCGTATCGGA".tovec(); let ltfmindexto_save = LtFmIndexBuilder::new().build(text).unwrap();

// (2) Save lt-fm-index to buffer let mut buffer = Vec::new(); ltfmindextosave.save_to(&mut buffer).unwrap();

// (3) Load lt-fm-index from buffer let ltfmindexloaded = LtFmIndex::loadfrom(&buffer[..]).unwrap();

asserteq!(ltfmindextosave, ltfmindexloaded); ```

Repository

https://github.com/baku4/lt-fm-index

Doc

https://docs.rs/lt-fm-index/

Reference

• Ferragina, P., et al. (2004). An Alphabet-Friendly FM-Index, Springer Berlin Heidelberg: 150-160.
• Anderson, T. and T. J. Wheeler (2021). An optimized FM-index library for nucleotide and amino acid search, Cold Spring Harbor Laboratory.
• Wang, Y., X. Li, D. Zang, G. Tan and N. Sun (2018). Accelerating FM-index Search for Genomic Data Processing, ACM.
• Yuta Mori. libdivsufsort