LtFmIndex

lt-fm-index is library for locate and count nucleotide and amino acid sequence string.

Description

• Fm-index is a data structure for exact pattern matching.

• LtFmIndex have precalculated count lookup table for kmer occurrences.

  • The lookup table can locate first k-mer pattern at once.

    Features

• LtFmIndex is generated from Text

• LtFmIndex have two functions for Pattern
  • count: Count the number of times the Pattern appears in Text.
  • locate: Locate the start index in which the Pattern appears in Text.
• Supports four types of text.
  • NucleotideOnly: ACGT
  • NucleotideWithNoise: ACGT
  • AminoacidOnly: ACDEFGHIKLMNPQRSTVWY
  • AminoacidWithNoise: ACDEFGHIKLMNPQRSTVWY
• The last character of each text type (T, _, Y, _) is treated as a wildcard that can be assigned to all non-supported characters.
  • For example, in NucleotideOnly, pattern of ACGTXYZ can be matched with ACGTTTT. Because X, Y and Z are not in ACG (nucleotide except T). And lt-fm-index generated with text of ACGTXYZ indexes the text as ACGTTTT.

    Examples

1. Use LtFmIndex to count and locate pattern.

```rust use ltfmindex::LtFmIndexBuilder;

// (1) Define builder for lt-fm-index let builder = LtFmIndexBuilder::new() .usenucleotidewithnoise() .setlookuptablekmersize(4).unwrap() .setsuffixarraysampling_ratio(2).unwrap();

// (2) Generate lt-fm-index with text let text = b"CTCCGTACACCTGTTTCGTATCGGANNNN".tovec(); let ltfm_index = builder.build(text); // text is consumed

// (3) Match with pattern let pattern = b"TA".tovec(); // - count let count = ltfmindex.count(&pattern); asserteq!(count, 2); // - locate let locations = ltfmindex.locate(&pattern); assert_eq!(locations, vec![5,18]); ```

2. Save and load LtFmIndex

```rust use ltfmindex::{LtFmIndex, LtFmIndexBuilder};

// (1) Generate lt-fm-index let text = b"CTCCGTACACCTGTTTCGTATCGGA".tovec(); let ltfmindexto_save = LtFmIndexBuilder::new().build(text);

// (2) Save lt-fm-index to buffer let mut buffer = Vec::new(); ltfmindextosave.save_to(&mut buffer).unwrap();

// (3) Load lt-fm-index from buffer let ltfmindexloaded = LtFmIndex::loadfrom(&buffer[..]).unwrap();

asserteq!(ltfmindextosave, ltfmindexloaded); ```

Repository

https://github.com/baku4/lt-fm-index

Doc

https://docs.rs/lt-fm-index/

Reference

• Ferragina, P., et al. (2004). An Alphabet-Friendly FM-Index, Springer Berlin Heidelberg: 150-160.
• Anderson, T. and T. J. Wheeler (2021). An optimized FM-index library for nucleotide and amino acid search, Cold Spring Harbor Laboratory.
• Wang, Y., X. Li, D. Zang, G. Tan and N. Sun (2018). Accelerating FM-index Search for Genomic Data Processing, ACM.
• Yuta Mori. libdivsufsort