LT FM-Index

lt-fm-index is library for locate and count nucleotide and amino acid sequence string.
lt-fm-index use lookup table (LT) in count table

CAVEAT! This crate is not stable. Functions can be changed without notification.

Description

• Fm-index is a data structure used for pattern matching.
• LT is precalculated count table containing all kmer occurrences.

• With LT, you can find the first k-mer pattern at once.

  Features

• LtFmIndex is generated from Text

• LtFmIndex have two functions for Pattern
  • count: Count the number of times the Pattern appears in Text.
  • locate: Locate the start index in which the Pattern appears in Text.
• Supports four types of text.
  • NucleotideOnly supports a text with only genetic nucleotide sequence (ACGT).
  • NucleotideWithNoise supports a text containing non-nucleotide sequence.
  • AminoacidOnly supports a text with only amino acid sequence.
  • AminoacidWithNoise supports a text containing non-amino acid sequence.
• The last character of each text type is treated as a wildcard.
  • The last characters of each text type are T, , Y and .
  • Wildcard is assigned to all non-supported characters.
  • For example, in NucleotideOnly, pattern of ACGTXYZ can be matched with ACGTTTT. Because X, Y and Z are not in ACG (nucleotide except T). And lt-fm-index generated with text of ACGTXYZ indexes the text as ACGTTTT.
• BWT is stored with rank count tables in every 64 or 128 intervals.

  Examples

1. Use LtFmIndex to count and locate pattern.

```rust use ltfmindex::{FmIndex, LtFmIndexConfig};

// (1) Define configuration for lt-fm-index let config = LtFmIndexConfig::fornucleotide() .withnoise() .changekmersize(4).unwrap() .changesamplingratio(4).unwrap() .changebwtintervalto128();

// (2) Generate fm-index with text let text = b"CTCCGTACACCTGTTTCGTATCGGANNNN".tovec(); let ltfm_index = config.generate(text).unwrap(); // text is consumed

// (3) Match with pattern let pattern = b"TA".tovec(); // - count let count = ltfmindex.count(&pattern); asserteq!(count, 2); // - locate let locations = ltfmindex.locate(&pattern); assert_eq!(locations, vec![5,18]); ```

2. Write and read LtFmIndex

```rust use ltfmindex::{LtFmIndexConfig, LtFmIndexAll, IO};

// (1) Generate FmIndex let config = LtFmIndexConfig::fornucleotide(); let text = b"CTCCGTACACCTGTTTCGTATCGGA".tovec(); let ltfmindex = config.generate(text).unwrap(); // text is consumed

// (2) Write fm-index to buffer (or file path) let mut buffer = Vec::new(); ltfmindex.write_to(&mut buffer).unwrap();

// (3) Read fm-index from buffer (or file path) let ltfmindexbuf = LtFmIndexAll::readfrom(&buffer[..]).unwrap();

asserteq!(ltfmindex, ltfmindexbuf); ```

Repository

https://github.com/baku4/lt-fm-index

Doc

https://docs.rs/lt-fm-index/

Reference

• Ferragina, P., et al. (2004). An Alphabet-Friendly FM-Index, Springer Berlin Heidelberg: 150-160.
• Anderson, T. and T. J. Wheeler (2021). An optimized FM-index library for nucleotide and amino acid search, Cold Spring Harbor Laboratory.
• Wang, Y., X. Li, D. Zang, G. Tan and N. Sun (2018). Accelerating FM-index Search for Genomic Data Processing, ACM.
• Yuta Mori. libdivsufsort