# `bio-seq` ### Bit-packed and well-typed biological sequences

```rust use bioseq::{dna, Seq, FromStr}; use bioseq::codec::{dna::Dna, ReverseComplement};

let seq = dna!("ATACGATCGATCGATCGATCCGT");

// iterate over the 8-mers of the reverse complement for kmer in seq.revcomp().kmers::<8>() { println!("{}", kmer); } ```

The IUPAC nucleotide ambiguity codes naturally encode a set of bases for each position:

```rust let seq = iupac!("AGCTNNCAGTCGACGTATGTA"); let pattern = Seq::::from_str("AYG").unwrap();

for slice in seq.windows(pattern.len()) { if pattern.contains(slice) { println!("{} matches pattern", slice); } } ```

The primary design goal of this crate is to make translating between biological sequence types safe and convenient:

rust // debruijn sequence of order 3 let seq: Seq<Dna> = dna!("AATTTGTGGGTTCGTCTGCGGCTCCGCCCTTAGTACTATGAGGACGATCAGCACCATAAGAACAAA"); let aminos: Seq<Amino> = Seq::from_vec(seq.kmers().map(|kmer| kmer.into()).collect()); assert_eq!( aminos, amino!("NIFLCVWGGVFSRVSLCARGALSPRAPPLL*SVYTLYM*ERGDTRDISQSAHTPHI*KRENTQK") );

Contents

Codecs

The Codec trait describes the coding/decoding process for the characters of a biological sequence. This trait can be derived procedurally. There are three built-in codecs:

codec::Dna

Using the lexicographically ordered 2-bit representation

codec::Iupac

IUPAC nucleotide ambiguity codes are represented with 4 bits. This supports membership resolution with bitwise operations. Logical or is the union:

rust assert_eq!(iupac!("AS-GYTNA") | iupac!("ANTGCAT-"), iupac!("ANTGYWNA"));

Logical and is the intersection of two iupac sequences:

rust assert_eq!(iupac!("ACGTSWKM") & iupac!("WKMSTNNA"), iupac!("A----WKA"));

codec::Amino

Amino acid sequences are represented with 6 bits. The representation of amino acids is designed to be easy to coerce from sequences of 2-bit encoded DNA.

Sequences

Strings of encoded biological characters are packed into Seqs. Slicing, chunking, and windowing return SeqSlices. Seq<A: Codec>/&SeqSlice<A: Codec> are analogous to String/&str.

Kmers

kmers are sequences with a fixed size that can fit into a register. these are implemented with const generics.

Dense encodings

For dense encodings, a lookup table can be populated and indexed in constant time with the usize representation:

rust let mut histogram = vec![0; 1 << C::WIDTH * K];

Hashing

The Hash trait is implemented for Kmers

Canonical Kmers

Depending on the application, it may be permissible to superimpose the forward and reverse complements of a kmer:

rust k = kmer!("ACGTGACGT"); let canonical = k ^ k.revcomp(); // TODO: implement ReverseComplement for Kmer

Kmer minimisers

The 2-bit representation of DNA sequences is lexicographically ordered:

rust fn minimise(seq: Seq<Dna>) -> Option<Kmer::<Dna, 8>> { seq.kmers().min() }

Example: Hashing minimiser of canonical Kmers

rust for ckmer in seq.window(8).map(|kmer| hash(kmer ^ kmer.revcomp())) { // TODO: example ... }

Derivable codecs

Sequence coding/decoding is derived from the variant names and discriminants of enum types:

```rust use bioseqderive::Codec; use bio_seq::codec::{Codec, ParseBioErr};

[derive(Clone, Copy, Debug, PartialEq, Codec)]

[width = 2]

[repr(u8)]

pub enum Dna { A = 0b00, C = 0b01, G = 0b10, T = 0b11, }

impl From for u8 { fn from(dna: Dna) -> Self { dna as u8 } } ```

The width attribute specifies how many bits the encoding requires per symbol. The maximum supported is 8.

Kmers are stored as usizes with the least significant bit first.

Sequence conversions

Iupac from Dna; Seq<Iupac> from Seq<Dna>

Amino from Kmer<3>; Seq<Amino> from Seq<Dna> * Sequence length not a multiple of 3 is an error

Seq<Iupac> from Amino; Seq<Iupac> from Seq<Amino> (TODO)

Vec<Seq<Dna>> from Seq<Iupac>: A sequence of IUPAC codes can generate a list of DNA sequences of the same length. (TODO)