ATG

Convert your genomic reference data between formats with a single tool. ATG handles the conversion from and to GTF, GenePred(ext) and Refgene. You can generate bed files, fasta sequences or custom feature sequences. A single tool for all your conversion.

| File format | Can be used as source | Can be created | | ----------- | ------------- | -------- | | GTF | Yes | Yes | | GenePred (extended) | Yes | Yes | | RefGene | Yes | Yes | | GenePred (simple) | No | Yes | | Bed | No | Yes | | Fasta | No | Yes (multiple options) | | SpliceAI gene annotation | No | Yes |

Reasons to use ATG * No need to maintain multiple tools for one-way conversions (gtfToGenePred, genePredToGtf, etc). ATG handles many formats and can convert in both directions. * Speed: ATG is really fast - almost twice as fast as gtfToGenePred. * Robust parser: It handles GTF, GenePred with all extras according to spec. * Low memory footprint: It also runs on machines with little RAM. * Open for contributions: Every help is welcome improve ATG or to add more functionality. * You can also use ATG as a library for your own Rust projects.

ATG command line tool

Install

There are currently 3 different options how to install ATG:

cargo

The easiest way to install ATG is to use cargo (if you have cargo and rust installed) bash cargo install atg

Pre-built binaries

You can download pre-built binaries for Linux and Mac from Github.

From source

You can also build ATG from source (if you have the rust toolchains installed):

```bash git clone https://github.com/anergictcell/atg.git cd atg cargo build --release ````

Usage

The main CLI arguments are - -f, --from: Specify the file format of the source (e.g. gtf, genepredext, refgene) - -t, --to: Specify the target file format (e.g. gtf, genepred, bed, fasta etc) - -i, --input: Path to source file. (Use /dev/stdin if you are using atg in a pipe) - -o, --output: Path to target file. Existing files will be overwritten. (Use /dev/stdout if you are using atg in a pipe) - -v, -vv, -vvv: Verbosity (info, debug, trace) - -h, --help: Print the help dialog with detailed usage instructions.

Additional, optional arguments: - -g, --gtf-source: Specify the source for GTF output files. Defaults to atg - -r, --reference: Path of a reference genome fasta file. Required for fasta output

Examples:

```bash

Convert a GTF file to a RefGene file

atg --from gtf --to refgene --input /path/to/input.gtf --output /path/to/output.refgene

Convert a GTF file to a GenePred file

atg --from gtf --to genepred --input /path/to/input.gtf --output /path/to/output.genepred

Convert a GTF file to a GenePredExt file

atg --from gtf --to genepredext --input /path/to/input.gtf --output /path/to/output.genepredext

Convert RefGene to GTF

atg --from refgene --to gtf --input /path/to/input.refgene --output /path/to/output.gtf

Convert RefGene to bed

atg --from refgene --to bed --input /path/to/input.refgene --output /path/to/output.bed ```

Supported --output formats

gtf

Output in GTF format.

text chr9 ncbiRefSeq.2021-05-17 transcript 74526555 74600974 . + . gene_id "C9orf85"; transcript_id "NM_001365057.2"; chr9 ncbiRefSeq.2021-05-17 exon 74526555 74526752 . + . gene_id "C9orf85"; transcript_id "NM_001365057.2"; chr9 ncbiRefSeq.2021-05-17 5UTR 74526555 74526650 . + . gene_id "C9orf85"; transcript_id "NM_001365057.2"; chr9 ncbiRefSeq.2021-05-17 CDS 74526651 74526752 . + 0 gene_id "C9orf85"; transcript_id "NM_001365057.2"; chr9 ncbiRefSeq.2021-05-17 exon 74561922 74562028 . + . gene_id "C9orf85"; transcript_id "NM_001365057.2"; chr9 ncbiRefSeq.2021-05-17 CDS 74561922 74562026 . + 0 gene_id "C9orf85"; transcript_id "NM_001365057.2"; ...

You can specify the value of the source column manually using the --gtf-source/-g option. Defaults to atg

refgene

Output in the refGene format, as used by some UCSC and NCBI RefSeq services

text 0 NM_001101.5 chr7 - 5566778 5570232 5567378 5569288 6 5566778,5567634,5567911,5568791,5569165,5570154, 5567522,5567816,5568350,5569031,5569294,5570232, 0 ACTB cmpl cmpl 0,1,0,0,0,-1, 0 NM_001203247.2 chr7 - 148504474 148581383 148504737 148544390 20 148504474,148506162,148506401,148507424,148508716,148511050,148512005,148512597,148513775,148514313,148514968,148516687,148523560,148524255,148525831,148526819,148529725,148543561,148544273,148581255, 148504798,148506247,148506482,148507506,148508812,148511229,148512131,148512638,148513870,148514483,148515209,148516779,148523724,148524358,148525972,148526940,148529842,148543690,148544397,148581383, 0 EZH2 cmpl cmpl 2,1,1,0,0,1,1,2,0,1,0,1,2,1,1,0,0,0,0,-1, 0 NM_001203248.2 chr7 - 148504474 148581383 148504737 148544390 20 148504474,148506162,148506401,148507424,148508716,148511050,148512005,148512597,148513775,148514313,148514968,148516687,148523560,148524255,148525831,148526819,148529725,148543588,148544273,148581255, 148504798,148506247,148506482,148507506,148508812,148511229,148512131,148512638,148513870,148514483,148515209,148516779,148523724,148524358,148525972,148526940,148529842,148543690,148544397,148581383, 0 EZH2 cmpl cmpl 2,1,1,0,0,1,1,2,0,1,0,1,2,1,1,0,0,0,0,-1, 0 NM_001354750.2 chr11 + 113930432 114127487 113934022 114121277 7 113930432,113933932,114027058,114057673,114112888,114117919,114121047, 113930864,113935290,114027156,114057760,114113059,114118087,114127487, 0 ZBTB16 cmpl cmpl -1,0,2,1,1,1,1,

genepred(ext)

Output in the GenePred(Ext) format, as used by some UCSC and NCBI RefSeq services

GenePred: text NM_001101.5 chr7 - 5566778 5570232 5567378 5569288 6 5566778,5567634,5567911,5568791,5569165,5570154, 5567522,5567816,5568350,5569031,5569294,5570232, NM_001203247.2 chr7 - 148504474 148581383 148504737 148544390 20 148504474,148506162,148506401,148507424,148508716,148511050,148512005,148512597,148513775,148514313,148514968,148516687,148523560,148524255,148525831,148526819,148529725,148543561,148544273,148581255, 148504798,148506247,148506482,148507506,148508812,148511229,148512131,148512638,148513870,148514483,148515209,148516779,148523724,148524358,148525972,148526940,148529842,148543690,148544397,148581383, NM_001203248.2 chr7 - 148504474 148581383 148504737 148544390 20 148504474,148506162,148506401,148507424,148508716,148511050,148512005,148512597,148513775,148514313,148514968,148516687,148523560,148524255,148525831,148526819,148529725,148543588,148544273,148581255, 148504798,148506247,148506482,148507506,148508812,148511229,148512131,148512638,148513870,148514483,148515209,148516779,148523724,148524358,148525972,148526940,148529842,148543690,148544397,148581383, NM_001354750.2 chr11 + 113930432 114127487 113934022 114121277 7 113930432,113933932,114027058,114057673,114112888,114117919,114121047, 113930864,113935290,114027156,114057760,114113059,114118087,114127487,

GenePredExt text NM_001101.5 chr7 - 5566778 5570232 5567378 5569288 6 5566778,5567634,5567911,5568791,5569165,5570154, 5567522,5567816,5568350,5569031,5569294,5570232, 0 ACTB cmpl cmpl 0,1,0,0,0,-1, NM_001203247.2 chr7 - 148504474 148581383 148504737 148544390 20 148504474,148506162,148506401,148507424,148508716,148511050,148512005,148512597,148513775,148514313,148514968,148516687,148523560,148524255,148525831,148526819,148529725,148543561,148544273,148581255, 148504798,148506247,148506482,148507506,148508812,148511229,148512131,148512638,148513870,148514483,148515209,148516779,148523724,148524358,148525972,148526940,148529842,148543690,148544397,148581383, 0 EZH2 cmpl cmpl 2,1,1,0,0,1,1,2,0,1,0,1,2,1,1,0,0,0,0,-1, NM_001203248.2 chr7 - 148504474 148581383 148504737 148544390 20 148504474,148506162,148506401,148507424,148508716,148511050,148512005,148512597,148513775,148514313,148514968,148516687,148523560,148524255,148525831,148526819,148529725,148543588,148544273,148581255, 148504798,148506247,148506482,148507506,148508812,148511229,148512131,148512638,148513870,148514483,148515209,148516779,148523724,148524358,148525972,148526940,148529842,148543690,148544397,148581383, 0 EZH2 cmpl cmpl 2,1,1,0,0,1,1,2,0,1,0,1,2,1,1,0,0,0,0,-1, NM_001354750.2 chr11 + 113930432 114127487 113934022 114121277 7 113930432,113933932,114027058,114057673,114112888,114117919,114121047, 113930864,113935290,114027156,114057760,114113059,114118087,114127487, 0 ZBTB16 cmpl cmpl -1,0,2,1,1,1,1,

bed

Output in bed format.

text chr7 5566778 5570232 ACTB:NM_001101.5 - 5567378 5569288 212,16,48 6 744,182,439,240,129,78 0,856,1133,2013,2387,3376 chr11 113930432 114127487 ZBTB16:NM_001354750.2 + 113934022 114121277 212,16,48 7 432,1358,98,87,171,168,6440 0,3500,96626,127241,182456,187487,190615 chr17 40852292 40897058 EZH1:NM_001321082.2 - 40854549 40880959 212,16,48 20 2318,85,81,82,96,179,126,41,92,197,181,92,164,103,177,121,129,128,91,30 0,2602,3465,4327,4813,5732,7683,8601,9571,12014,12934,17701,18179,18830,19998,22520,27360,28550,30553,44736

fasta

Writes the cDNA sequence of all transcripts into one file. Please note that the sequence is stranded.

This target format requires a reference genome fasta file that must be specified using --reference/-r.

This output allows different --fasta-format options: - transcript: The full transcript sequence (from the genomic start to end position, including introns) - exons: The cDNA sequence of the processed transcript, i.e. the sequence of all exons, including non-coding exons. - cds (default): The CDS of the transcript

```text

NM007298.3 BRCA1 ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGC TATGCAGAAAATCTTAGAGTGTCCCATCTGTCTGGAGTTGATCAAGGAAC CTGTCTCCACAAAGTGTGACCACATATTTTGCAAATTTTGCATGCTGAAA CTTCTCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTATGTAAGAATGA TATAACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGTCAACTTGTTG ... NM001365057.2 C9orf85 ATGAGCTCCCAGAAAGGCAACGTGGCTCGTTCCAGACCTCAGAAGCACCA GAATACGTTTAGCTTCAAAAATGACAAGTTCGATAAAAGTGTGCAGACCA AGAAAATTAATGCAAAACTTCATGATGGAGTATGTCAGCGCTGTAAAGAA GTTCTTGAGTGGCGTGTAAAATACAGCAAATACAAACCATTATCAAAACC TAAAAAGTGA ... ```

fasta-split

Like fasta above, but one file for each transcript. Instead of an output file, you must specify an output directory, ATG will save each transcript as <Transcript_name>.fasta, e.g.: NM_001365057.2.fasta.

This target format requires a reference genome fasta file that must be specified using --reference/-r.

This output allows different --fasta-format options: - transcript: The full transcript sequence (from the genomic start to end position, including introns) - exons: The cDNA sequence of the processed transcript, i.e. the sequence of all exons, including non-coding exons. - cds (default): The CDS of the transcript

feature-sequence

cDNA sequence of each feature (5' UTR, CDS, 3'UTR), each in a separate row.

This target format requires a reference genome fasta file that must be specified using --reference/-r.

text BRCA1 NM_007298.3 chr17 41196311 41197694 - 3UTR CTGCAGCCAGCCAC... BRCA1 NM_007298.3 chr17 41197694 41197819 - CDS CAATTGGGCAGATGTGTG... BRCA1 NM_007298.3 chr17 41199659 41199720 - CDS GGTGTCCACCCAATTGTG... BRCA1 NM_007298.3 chr17 41201137 41201211 - CDS ATCAACTGGAATGGATGG... BRCA1 NM_007298.3 chr17 41203079 41203134 - CDS ATCTTCAGGGGGCTAGAA... BRCA1 NM_007298.3 chr17 41209068 41209152 - CDS CATGATTTTGAAGTCAGA... BRCA1 NM_007298.3 chr17 41215349 41215390 - CDS GGGTGACCCAGTCTATTA... BRCA1 NM_007298.3 chr17 41215890 41215968 - CDS ATGCTGAGTTTGTGTGTG... BRCA1 NM_007298.3 chr17 41219624 41219712 - CDS ATGCTCGTGTACAAGTTT... BRCA1 NM_007298.3 chr17 41222944 41223255 - CDS AGGGAACCCCTTACCTGG... C9orf85 NM_001365057.2 chr9 74526555 74526650 + 5UTR ATTGACAGAA... C9orf85 NM_001365057.2 chr9 74526651 74526752 + CDS ATGAGCTCCCAGAA... C9orf85 NM_001365057.2 chr9 74561922 74562028 + CDS AAAATTAATGCAAA... C9orf85 NM_001365057.2 chr9 74597573 74597573 + CDS A C9orf85 NM_001365057.2 chr9 74597574 74600974 + 3UTR TGGAGTCTCC...

spliceai

This is a custom format useful for SpliceAI splice predictions. The repo lists example files. The output has one gene per row, each gene record contains a consensus transcript, created by merging overlapping exons.

```text

NAME CHROM STRAND TXSTART TXEND EXONSTART EXONEND

OR4F5 1 + 69090 70008 69090, 70008, AL627309.1 1 - 134900 139379 134900,137620, 135802,139379, ```

raw

This is mainly useful for debugging, as it gives a quick glimpse into the Exons and CDS coordinates of the transcripts.

bin

Save Transcripts in ATG binary format for faster re-reading.

ATG as library

ATG uses the atglib library, which is documented inline and available on docs.rs

Known issues

GTF parsing