Convert your genomic reference data between formats with a single tool. ATG handles the conversion from and to GTF, GenePred(ext) and Refgene. You can generate bed files, fasta sequences or custom feature sequences. A single tool for all your conversion.
| File format | Can be used as source | Can be created | | ----------- | ------------- | -------- | | GTF | Yes | Yes | | GenePred (extended) | Yes | Yes | | RefGene | Yes | Yes | | GenePred (simple) | No | Yes | | Bed | No | Yes | | Fasta | No | Yes (multiple options) |
Reasons to use ATG
* No need to maintain multiple tools for one-way conversions (gtfToGenePred
, genePredToGtf
, etc). ATG handles many formats and can convert in both directions.
* Speed: ATG is really fast - almost twice as fast as gtfToGenePred
.
* Robust parser: It handles GTF, GenePred with all extras according to spec.
* Low memory footprint: It also runs on machines with little RAM.
* Open for contributions: Every help is welcome improve ATG or to add more functionality.
* You can also use ATG as a library for your own Rust projects.
There are currently 3 different options how to install ATG:
The easiest way to install ATG is to use cargo
(if you have cargo
and rust
installed)
bash
cargo install atg
You can download pre-built binaries for Linux and Mac (M1) from Github.
You can also build ATG from source (if you have the rust toolchains installed):
```bash git clone https://github.com/anergictcell/atg.git cd atg cargo build --release ````
The main CLI arguments are
- -f
, --from
: Specify the file format of the source (e.g. gtf
, genepredext
, refgene
)
- -t
, --to
: Specify the target file format (e.g. gtf
, genepred
, bed
, fasta
etc)
- -i
, --input
: Path to source file. (Use /dev/stdin
if you are using atg in a pipe)
- -o
, --output
: Path to target file. Existing files will be overwritten. (Use /dev/stdout
if you are using atg in a pipe)
- -v
, -vv
, -vvv
: Verbosity (info, debug, trace)
- -h
, --help
: Print the help dialog with detailed usage instructions.
Additional, optional arguments:
- -g
, --gtf-source
: Specify the source for GTF output files. Defaults to atg
- -r
, --reference
: Path of a reference genome fasta file. Required for fasta output
```bash
atg --from gtf --to refgene --input /path/to/input.gtf --output /path/to/output.refgene
atg --from gtf --to genepred --input /path/to/input.gtf --output /path/to/output.genepred
atg --from gtf --to genepredext --input /path/to/input.gtf --output /path/to/output.genepredext
atg --from refgene --to gtf --input /path/to/input.refgene --output /path/to/output.gtf
atg --from refgene --to bed --input /path/to/input.refgene --output /path/to/output.bed ```
--output
formatsOutput in GTF format.
text
chr9 ncbiRefSeq.2021-05-17 transcript 74526555 74600974 . + . gene_id "C9orf85"; transcript_id "NM_001365057.2";
chr9 ncbiRefSeq.2021-05-17 exon 74526555 74526752 . + . gene_id "C9orf85"; transcript_id "NM_001365057.2";
chr9 ncbiRefSeq.2021-05-17 5UTR 74526555 74526650 . + . gene_id "C9orf85"; transcript_id "NM_001365057.2";
chr9 ncbiRefSeq.2021-05-17 CDS 74526651 74526752 . + 0 gene_id "C9orf85"; transcript_id "NM_001365057.2";
chr9 ncbiRefSeq.2021-05-17 exon 74561922 74562028 . + . gene_id "C9orf85"; transcript_id "NM_001365057.2";
chr9 ncbiRefSeq.2021-05-17 CDS 74561922 74562026 . + 0 gene_id "C9orf85"; transcript_id "NM_001365057.2";
...
You can specify the value of the source
column manually using the --gtf-source
/-g
option. Defaults to atg
Output in the refGene format, as used by some UCSC and NCBI RefSeq services
text
0 NM_001101.5 chr7 - 5566778 5570232 5567378 5569288 6 5566778,5567634,5567911,5568791,5569165,5570154, 5567522,5567816,5568350,5569031,5569294,5570232, 0 ACTB cmpl cmpl 0,1,0,0,0,-1,
0 NM_001203247.2 chr7 - 148504474 148581383 148504737 148544390 20 148504474,148506162,148506401,148507424,148508716,148511050,148512005,148512597,148513775,148514313,148514968,148516687,148523560,148524255,148525831,148526819,148529725,148543561,148544273,148581255, 148504798,148506247,148506482,148507506,148508812,148511229,148512131,148512638,148513870,148514483,148515209,148516779,148523724,148524358,148525972,148526940,148529842,148543690,148544397,148581383, 0 EZH2 cmpl cmpl 2,1,1,0,0,1,1,2,0,1,0,1,2,1,1,0,0,0,0,-1,
0 NM_001203248.2 chr7 - 148504474 148581383 148504737 148544390 20 148504474,148506162,148506401,148507424,148508716,148511050,148512005,148512597,148513775,148514313,148514968,148516687,148523560,148524255,148525831,148526819,148529725,148543588,148544273,148581255, 148504798,148506247,148506482,148507506,148508812,148511229,148512131,148512638,148513870,148514483,148515209,148516779,148523724,148524358,148525972,148526940,148529842,148543690,148544397,148581383, 0 EZH2 cmpl cmpl 2,1,1,0,0,1,1,2,0,1,0,1,2,1,1,0,0,0,0,-1,
0 NM_001354750.2 chr11 + 113930432 114127487 113934022 114121277 7 113930432,113933932,114027058,114057673,114112888,114117919,114121047, 113930864,113935290,114027156,114057760,114113059,114118087,114127487, 0 ZBTB16 cmpl cmpl -1,0,2,1,1,1,1,
Output in the GenePred(Ext) format, as used by some UCSC and NCBI RefSeq services
GenePred:
text
NM_001101.5 chr7 - 5566778 5570232 5567378 5569288 6 5566778,5567634,5567911,5568791,5569165,5570154, 5567522,5567816,5568350,5569031,5569294,5570232,
NM_001203247.2 chr7 - 148504474 148581383 148504737 148544390 20 148504474,148506162,148506401,148507424,148508716,148511050,148512005,148512597,148513775,148514313,148514968,148516687,148523560,148524255,148525831,148526819,148529725,148543561,148544273,148581255, 148504798,148506247,148506482,148507506,148508812,148511229,148512131,148512638,148513870,148514483,148515209,148516779,148523724,148524358,148525972,148526940,148529842,148543690,148544397,148581383,
NM_001203248.2 chr7 - 148504474 148581383 148504737 148544390 20 148504474,148506162,148506401,148507424,148508716,148511050,148512005,148512597,148513775,148514313,148514968,148516687,148523560,148524255,148525831,148526819,148529725,148543588,148544273,148581255, 148504798,148506247,148506482,148507506,148508812,148511229,148512131,148512638,148513870,148514483,148515209,148516779,148523724,148524358,148525972,148526940,148529842,148543690,148544397,148581383,
NM_001354750.2 chr11 + 113930432 114127487 113934022 114121277 7 113930432,113933932,114027058,114057673,114112888,114117919,114121047, 113930864,113935290,114027156,114057760,114113059,114118087,114127487,
GenePredExt
text
NM_001101.5 chr7 - 5566778 5570232 5567378 5569288 6 5566778,5567634,5567911,5568791,5569165,5570154, 5567522,5567816,5568350,5569031,5569294,5570232, 0 ACTB cmpl cmpl 0,1,0,0,0,-1,
NM_001203247.2 chr7 - 148504474 148581383 148504737 148544390 20 148504474,148506162,148506401,148507424,148508716,148511050,148512005,148512597,148513775,148514313,148514968,148516687,148523560,148524255,148525831,148526819,148529725,148543561,148544273,148581255, 148504798,148506247,148506482,148507506,148508812,148511229,148512131,148512638,148513870,148514483,148515209,148516779,148523724,148524358,148525972,148526940,148529842,148543690,148544397,148581383, 0 EZH2 cmpl cmpl 2,1,1,0,0,1,1,2,0,1,0,1,2,1,1,0,0,0,0,-1,
NM_001203248.2 chr7 - 148504474 148581383 148504737 148544390 20 148504474,148506162,148506401,148507424,148508716,148511050,148512005,148512597,148513775,148514313,148514968,148516687,148523560,148524255,148525831,148526819,148529725,148543588,148544273,148581255, 148504798,148506247,148506482,148507506,148508812,148511229,148512131,148512638,148513870,148514483,148515209,148516779,148523724,148524358,148525972,148526940,148529842,148543690,148544397,148581383, 0 EZH2 cmpl cmpl 2,1,1,0,0,1,1,2,0,1,0,1,2,1,1,0,0,0,0,-1,
NM_001354750.2 chr11 + 113930432 114127487 113934022 114121277 7 113930432,113933932,114027058,114057673,114112888,114117919,114121047, 113930864,113935290,114027156,114057760,114113059,114118087,114127487, 0 ZBTB16 cmpl cmpl -1,0,2,1,1,1,1,
Output in bed format.
text
chr7 5566778 5570232 ACTB:NM_001101.5 - 5567378 5569288 212,16,48 6 744,182,439,240,129,78 0,856,1133,2013,2387,3376
chr11 113930432 114127487 ZBTB16:NM_001354750.2 + 113934022 114121277 212,16,48 7 432,1358,98,87,171,168,6440 0,3500,96626,127241,182456,187487,190615
chr17 40852292 40897058 EZH1:NM_001321082.2 - 40854549 40880959 212,16,48 20 2318,85,81,82,96,179,126,41,92,197,181,92,164,103,177,121,129,128,91,30 0,2602,3465,4327,4813,5732,7683,8601,9571,12014,12934,17701,18179,18830,19998,22520,27360,28550,30553,44736
Writes the cDNA sequence of all transcripts into one file. Please note that the sequence is stranded.
This target format requires a reference genome fasta file that must be specified using --reference
/-r
.
This output allows different --fasta-format
options:
- transcript
: The full transcript sequence (from the genomic start to end position, including introns)
- exons
: The cDNA sequence of the processed transcript, i.e. the sequence of all exons, including non-coding exons.
- cds
(default): The CDS of the transcript
```text
NM007298.3 BRCA1 ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGC TATGCAGAAAATCTTAGAGTGTCCCATCTGTCTGGAGTTGATCAAGGAAC CTGTCTCCACAAAGTGTGACCACATATTTTGCAAATTTTGCATGCTGAAA CTTCTCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTATGTAAGAATGA TATAACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGTCAACTTGTTG ... NM001365057.2 C9orf85 ATGAGCTCCCAGAAAGGCAACGTGGCTCGTTCCAGACCTCAGAAGCACCA GAATACGTTTAGCTTCAAAAATGACAAGTTCGATAAAAGTGTGCAGACCA AGAAAATTAATGCAAAACTTCATGATGGAGTATGTCAGCGCTGTAAAGAA GTTCTTGAGTGGCGTGTAAAATACAGCAAATACAAACCATTATCAAAACC TAAAAAGTGA ... ```
Like fasta
above, but one file for each transcript. Instead of an output file, you must specify an output directory, ATG will save each transcript as <Transcript_name>.fasta
, e.g.: NM_001365057.2.fasta
.
This target format requires a reference genome fasta file that must be specified using --reference
/-r
.
This output allows different --fasta-format
options:
- transcript
: The full transcript sequence (from the genomic start to end position, including introns)
- exons
: The cDNA sequence of the processed transcript, i.e. the sequence of all exons, including non-coding exons.
- cds
(default): The CDS of the transcript
cDNA sequence of each feature (5' UTR, CDS, 3'UTR), each in a separate row.
This target format requires a reference genome fasta file that must be specified using --reference
/-r
.
text
BRCA1 NM_007298.3 chr17 41196311 41197694 - 3UTR CTGCAGCCAGCCAC...
BRCA1 NM_007298.3 chr17 41197694 41197819 - CDS CAATTGGGCAGATGTGTG...
BRCA1 NM_007298.3 chr17 41199659 41199720 - CDS GGTGTCCACCCAATTGTG...
BRCA1 NM_007298.3 chr17 41201137 41201211 - CDS ATCAACTGGAATGGATGG...
BRCA1 NM_007298.3 chr17 41203079 41203134 - CDS ATCTTCAGGGGGCTAGAA...
BRCA1 NM_007298.3 chr17 41209068 41209152 - CDS CATGATTTTGAAGTCAGA...
BRCA1 NM_007298.3 chr17 41215349 41215390 - CDS GGGTGACCCAGTCTATTA...
BRCA1 NM_007298.3 chr17 41215890 41215968 - CDS ATGCTGAGTTTGTGTGTG...
BRCA1 NM_007298.3 chr17 41219624 41219712 - CDS ATGCTCGTGTACAAGTTT...
BRCA1 NM_007298.3 chr17 41222944 41223255 - CDS AGGGAACCCCTTACCTGG...
C9orf85 NM_001365057.2 chr9 74526555 74526650 + 5UTR ATTGACAGAA...
C9orf85 NM_001365057.2 chr9 74526651 74526752 + CDS ATGAGCTCCCAGAA...
C9orf85 NM_001365057.2 chr9 74561922 74562028 + CDS AAAATTAATGCAAA...
C9orf85 NM_001365057.2 chr9 74597573 74597573 + CDS A
C9orf85 NM_001365057.2 chr9 74597574 74600974 + 3UTR TGGAGTCTCC...
This is mainly useful for debugging, as it gives a quick glimpse into the Exons and CDS coordinates of the transcripts.
Save Transcripts in ATG binary format for faster re-reading.
The library API is mostly documented inline and available on docs.rs
```rust use atg::gtf::Reader; use atg::refgene::Writer; use atg::models::{TranscriptRead, TranscriptWrite};
let mut reader = Reader::fromfile("tests/data/example.gtf") .unwraporelse(|| panic!("Error opening input file."));
let mut writer = Writer::fromfile("/dev/null") .unwraporelse(|| panic!("Unable to open output file"));
let transcripts = reader.transcripts() .unwraporelse(|err| panic!("Error parsing GTF: {}", err));
match writer.writetranscripts(&transcripts) { Ok() => println!("Success"), Err(err) => panic!("Error writing RefGene file: {}", err) }; ```
chr
prefix